RegulonDB RegulonDB 10.9: Gene Sequence
citE gene sequence


Size: 909        A: 192  T: 194  G: 251  C: 272

Fasta

 

>citE E. coli K12. Version NC_000913.3 GI:556503834
atgatttccgcttcgctgcaacaacgtaaaactcgcacccgccgcagcatgttgtttgtg
cctggtgccaatgccgcgatggtcagcaactccttcatctacccggctgatgccctgatg
tttgacctcgaagactccgtagcattgcgtgaaaaagacaccgcccgccgcatggtttac
cacgcgctgcaacatccgctgtatcgcgatattgaaaccattgtgcgtgtcaacgcgctg
gattccgaatggggtgttaacgacctggaagccgtcgttcgcggtggtgcggacgttgtg
cgtctgccgaaaaccgataccgctcaggatgttctggatattgaaaaagagatcctgcgt
atcgaaaaagcctgtggtcgtgaacccggcagcaccggcctgctggcggcgattgaatct
ccgctggggattacccgcgcagtggaaatcgctcacgcttccgagcgtttgatcggtatc
gccctcggtgcagaagactatgtgcgcaacctgcgtacagaacgctccccggaaggaact
gaactgctgttcgcacgctgttccattttgcaggccgcgcgctctgcgggtattcaggcg
ttcgataccgtctattccgacgctaacaacgaagccggatttctgcaagaagccgcccac
atcaaacagctgggctttgacggcaaatcgctgatcaacccgcgtcagattgatctgctg
cacaacctctacgcaccgacccagaaagaagtggatcacgcccgccgcgtcgtagaagcc
gctgaagccgccgctcgcgaaggcctcggcgtggtttccctgaacggcaagatggtggac
ggtccggttatcgatcgcgcccgtctggtgctctcccgtgcagaactttccggcatccgc
gaagaataa
              
                            

Download fasta file
RegulonDB