RegulonDB RegulonDB 10.8: Gene Sequence
chiQ gene sequence


Size: 327        A: 110  T: 60  G: 85  C: 72

Fasta

 

>chiQ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaactgattctcatcgccataatggcatcggggctggtagcttgtgcgcaatca
accgcgccacaggaagacagtcgtctgaaagaggcatacagcgcctgtatcaacaccgca
caaggttcgccagaaaaaattgaagcctgccagagcgtgttaaacgtgctgaagaaagag
aaacaacatcagcagtttgccgaccaggaaagtgtacgcgtactggattatcagcagtgt
ctgcgtgcaacgcaaaccggaaatgatcaggcggtgaaagccgattgtgataaagtctgg
caggaaatacgcagtaataacaaataa
              
                            

Download fasta file
RegulonDB