RegulonDB RegulonDB 10.9: Gene Sequence
nei gene sequence


Size: 792        A: 182  T: 195  G: 216  C: 199

Fasta

 

>nei E. coli K12. Version NC_000913.3 GI:556503834
atgcctgaaggcccggagatccgccgtgcagcggataacctggaggcggcgatcaaaggc
aaaccactaactgatgtctggtttgccttcccgcagttaaaaccttatcaatcacaactt
atcggtcaacacgttacccatgtggaaacgcgtggtaaggcgttgttaactcatttttcc
aacgacttaacgctctacagccataatcagctttacggcgtctggcgcgtggttgatacc
ggcgaagagccgcagaccacgcgagtattgcgggtaaaactgcaaacggctgacaaaacc
attctgctttatagcgcctcggatattgagatgttgaccccggaacaactgaccacgcat
ccgtttttacaacgcgttggtcccgatgtgctggatccgaatctgacgccggaggtggtg
aaagaacgattattgtcgccgcgctttcgtaaccgtcagtttgctggattactgctcgat
caggcgtttctggctgggcttggcaattatttgcgggtggagatcctctggcaggttggg
ttgactggaaatcataaagcgaaagatctcaatgcggcgcaactggatgcactcgcacac
gcgttactggagattcctcgattttcctacgctacgcgggggcaggtggatgagaataag
catcatggggcgctgtttcgctttaaggtttttcatcgagatggcgaaccgtgcgaacgt
tgtggcagcatcattgagaaaaccacgctgtcatctcgcccgttttactggtgccctggc
tgccagcactag
              
                            

Download fasta file
RegulonDB