RegulonDB RegulonDB 10.9: Gene Sequence
fiu gene sequence


Size: 2283        A: 569  T: 485  G: 575  C: 654

Fasta

 

>fiu E. coli K12. Version NC_000913.3 GI:556503834
atggaaaacaatcgcaatttccctgccagacaatttcattcgctcacgttctttgccggt
ctttgtattggcatcacgcctgtggctcaggcactcgccgccgaagggcaaactaacgcg
gatgacacgctggttgtcgaagcatcaacgccttcgctttatgcgccacaacaatctgcc
gatccgaaattctcgcgtccggtagcggatactacccgcacgatgacggtaatttctgaa
caagtgattaaagatcagggcgcaaccaaccttaccgacgcgctcaaaaacgtccccggc
gtgggtgcgttttttgcgggtgagaacggtaactccaccactggcgacgccatttatatg
cgtggtgccgatacctctaacagtatttatattgatggcattcgcgatatcggcagcgtc
tcgcgcgacaccttcaataccgagcaggtcgaagtgattaaagggccgtccggcaccgac
tacgggcgcagcgcaccgacaggctcgatcaatatgatcagcaagcagccgcgcaatgat
tccggcattgacgcctccgccagtattggcagcgcctggttccgccgcggcacgctggac
gtcaatcaggtcattggtgataccaccgcggtgcgcctgaatgtaatgggcgaaaaaacg
cacgatgccggacgcgacaaagtcaaaaatgagcgttacggcgtcgccccttctgtcgct
tttggccttggtacagcgaatcgtttgtatcttaattatctgcatgtcacccagcacaac
acgccagacggcggcattccgaccatcggtttgccgggctattctgccccatctgcggga
acggcggccctgaatcattccggaaaagttgatactcataacttttacggcacggattcc
gattacgacgattcgaccaccgacaccgccaccatgcgttttgagcacgacatcaacgat
aacaccaccattcgcaatactacccgttggtcgcgcgtaaagcaggattacctgatgacg
gcgattatgggcggggcgtcgaatattactcagcccaccagcgatgtgaatagctggacc
tggtcacgcacggcgaataccaaagatgtgagtaataaaattctcaccaaccagaccaac
ctgacctcgacgttctataccggttctatcggtcatgatgtcagtaccggcgtggaattt
acccgtgaaacgcagactaactacggcgttaatccggtgacgttacccgcggtaaatatt
tatcatcctgacagcagcattcatcccggcggcctgacgcgcaacggcgcaaacgccaat
ggtcagacggataccttcgcaatttacgcctttgatacgctgcaaatcacccgtgatttt
gagctgaacggcgggatccgtctggataattatcatactgaatatgacagtgccaccgcc
tgcggcggcagcggacgcggtgccatcacctgcccaactggtgtggcaaaaggttctccg
gtcaccaccgtcgacaccgccaagtcgggcaatctgatgaactggaaagccggggcgctg
tatcacctgacggaaaacggcaatgtctatattaactatgccgtttcccagcagcctccg
ggcggcaacaacttcgcccttgcgcagtctggcagcggtaacagtgccaaccgcaccgat
tttaaaccgcaaaaagccaacaccagcgagattggcaccaaatggcaggttctggataaa
cgtctgttgctcaccgccgcgctgttccgcactgatatcgaaaatgaagttgagcaaaat
gatgacggaacttactcgcaatacggtaagaaacgcgtcgaaggctatgagatatccgtg
gccgggaatatcactcccgcgtggcaggtgattggcggctatacccagcaaaaagcaacc
atcaaaaacggcaaagatgttgcccaggatggttcctcatcgctgccgtataccccggag
cacgccttcaccttatggagccaatatcaggcaaccgacgatatctctgttggcgcgggc
gcacgctatatcggcagtatgcataaaggttcagacggcgcggtgggaacgccagcgttt
accgaaggttactgggtcgccgatgccaaactggggtatcgagttaatcgcaatctcgac
ttccagctaaacgtttacaacctgtttgataccgattacgtcgcctcaatcaacaagagc
ggctaccgttatcacccgggcgagccaagaaccttcttgctcacagccaatatgcatttc
tga
              
                            

Download fasta file
RegulonDB