RegulonDB RegulonDB 10.8: Gene Sequence
rlmF gene sequence


Size: 927        A: 222  T: 203  G: 263  C: 239

Fasta

 

>rlmF E. coli K12. Version NC_000913.3 GI:556503834
atgtccgcccagaaaccggggttgcatccgcgcaaccgtcatcacagccgctacgatctc
gccacgctttgtcaggtcaatcctgaactcaggcaattcctcacgcttacacccgccggg
gagcaaagcgtagactttgccaatccgctggcggtgaaggcgctcaataaggcgttgctg
gcccatttttacgccgtagcgaactgggatatccccgacggttttctctgcccaccagta
ccgggccgggcggattatattcatcaccttgccgatttactggcagaagcaagcggaaca
attccagcgaatgccagcattctggatatcggcgttggtgcgaactgtatttatccgctg
attggcgtacatgaatatggctggcgttttaccggtagtgaaaccagcagccaggcgtta
agcagtgcgcaggcgattatcagttctaatccggggcttaaccgcgccattcgtctgcgt
cggcaaaaagagagtggggcgatttttaacggcatcatccataaaaacgagcaatacgac
gcgaccttgtgtaacccgccattccacgattccgccgctgcggcacgggcaggtagtgag
cgtaaacgccgtaacctggggctgaacaaagacgatgcactgaactttggcggccagcaa
caggagttgtggtgtgaaggcggtgaagtcacctttatcaaaaagatgattgaagagagc
aaaggcttcgcgaagcaggtgatgtggtttacatcactggtatctcgtggtgaaaactta
ccgccgttgtatcgtgccctgacggacgtgggcgcggtgaaggtggttaaaaaagagatg
gcccaggggcaaaagcagagtcgctttattgcctggacctttatgaacgacgagcagcgc
cgccgttttgtcaatcgccagcgttaa
              
                            

Download fasta file
RegulonDB