RegulonDB RegulonDB 10.8: Gene Sequence
ybjM gene sequence


Size: 378        A: 73  T: 117  G: 100  C: 88

Fasta

 

>ybjM E. coli K12. Version NC_000913.3 GI:556503834
gtgaaacataaacaacgttgggcgggggcaatctgctgttttgtcctcttcattgtggtg
tgcctttttctggcgacgcacatgaaaggcgcttttcgggctgccgggcatcctgaaatc
ggcttgctatttttcattcttcctggagcagtcgccagcttcttttcacagcgtagagaa
gtcctgaaacctctgtttggcgcaatgctggcggcaccctgttcgatgctcattatgcgg
ctgtttttttcaccgacgcgctcattctggcaagagctggcatggttactaagcgcggtg
ttctggtgtgcgctgggggcactgtgtttcttatttatcagtagtttgtttaaaccacag
cacagaaaaaatcagtaa
              
                            

Download fasta file
RegulonDB