RegulonDB RegulonDB 10.8: Gene Sequence
ybjO gene sequence


Size: 489        A: 94  T: 140  G: 138  C: 117

Fasta

 

>ybjO E. coli K12. Version NC_000913.3 GI:556503834
atggaagacgaaacgttgggattttttaagaaaacatcttcatctcatgctcgcctgaat
gtgcctgcgctggtgcaggtggcggcgctcgccattattatgatccgtggcctcgacgtg
ctgatgattttcaatacgctgggcgtgcgcggtattggcgagttcattcatcgcagcgta
caaacctggagtttaacgctggtctttttaagcagtctggtgctggttttcattgagatc
tggtgtgcgttttcactggtgaaagggcgtcgctgggcgcgctggctatatctgctgaca
caaatcaccgccgcaagttacttgtgggcggcttcgctggggtacggttatccggagctg
ttcagcattcccggtgaatcaaaacgtgaaatcttccatagcctgatgctgcagaagctg
ccggatatgctcatcctgatgctgctgttcgttccctcgaccagtcggcggttcttccag
ttgcaataa
              
                            

Download fasta file
RegulonDB