RegulonDB RegulonDB 10.9: Gene Sequence
ybjP gene sequence


Size: 516        A: 124  T: 114  G: 127  C: 151

Fasta

 

>ybjP E. coli K12. Version NC_000913.3 GI:556503834
atgcgctacagcaaattgacaatgcttatcccctgcgcactgctcctcagtgcctgcacc
acagtcactccagcttataaagataacggcacacgcagtggtccttgcgttgaaggaggc
ccggataacgtggcccagcaattttatgactaccgcattttgcaccgcagcaacgacatc
accgccttgcgcccttatctgagcgacaaactggcgacactgcttagcgatgcctcccgg
gataataaccatcgggaactactgaccaacgatccattctccagtcgaaccaccttgcca
gatagcgcccacgttgccagtgcatcgactatccctaatcgtgatgcccgtaacattcca
ttgcgcgtggatctcaaacagggtgaccagggttggcaggatgaagtgttaatgattcag
gaaggccagtgttgggtcatcgacgatgtgcgttacttaggcggtagcgttcatgccacg
gcgggtacgctccgtcagtccatcgagaatcgctaa
              
                            

Download fasta file
RegulonDB