RegulonDB RegulonDB 10.10: Gene Sequence
hcp gene sequence


Size: 1653        A: 366  T: 382  G: 455  C: 450

Fasta

 

>hcp E. coli K12. Version NC_000913.3 GI:556503834
atgttttgtgtgcaatgtgaacaaactatccgtactccggcaggaaacggctgctcatac
gcgcaggggatgtgtggtaaaacggcggaaacttctgaccttcaggatttactcatcgcg
gcgctgcaagggctttctgcctgggcggtaaaagcgcgtgaatacggcatcatcaaccac
gatgttgacagcttcgcgccacgtgcctttttctcaaccctgaccaacgttaacttcgat
tctccgcgtattgtcggctacgctcgtgaagcgattgccctgcgcgaggcgctgaaagcg
caatgcctggctgtagatgccaacgcgcgcgtcgataacccgatggctgacctgcaactg
gtgagcgacgatctcggcgagctgcaacgtcaggcagcagaatttacccctaacaaagat
aaagcggcgattggcgaaaacattctcggcctgcgtctgctgtgcctgtatggcctgaaa
ggtgcggcggcctatatggaacacgcgcatgttctcggtcaatacgacaacgatatttat
gcccagtaccataaaatcatggcgtggctggggacctggcctgccgatatgaacgcgctt
cttgagtgttcaatggaaatcggccagatgaacttcaaagtgatgagcattctggatgca
ggcgaaaccggtaaatacggtcacccgacgccaacccaggtcaacgtcaaagcgacggcg
ggtaaatgcattctgatttccggtcacgatctcaaagatctctacaacctgctggaacag
accgaaggcacgggcgttaatgtctacacccacggcgaaatgctgcctgcgcatggctac
ccggagctgcgtaaattcaagcatctggtcggtaactacggcagcggctggcagaatcag
caagtggagttcgctcgtttccctggccccatcgtgatgacctcgaactgcatcatcgac
ccaaccgtaggcgcttatgacgatcgtatctggacccgcagcattgttggctggcctggc
gtgcgtcatctggacggtgatgatttctctgcggttatcacccaggcgcaacagatggca
ggcttcccgtacagcgaaattccgcaccttatcaccgtgggttttggtcgccagacgctg
cttggcgctgctgatacgctgattgatctggtgagccgtgaaaaactgcgtcatatcttc
ctgcttggtggctgtgacggcgcacgcggcgagcgccactacttcaccgatttcgccacc
agcgtgccggatgactgcctgatcctgaccctcgcctgtggtaaatatcgctttaacaaa
cttgagtttggcgatatcgaaggtctgccgcgtctggtagatgcaggtcaatgtaacgat
gcttactcagcgattattctggctgtcactctggcagagaaactgggctgcggtgtcaac
gatctgccgctgtcgctggtgctctcctggtttgaacagaaagcgatcgtcattctgctg
acgctgctttctctgggcgtgaaaaatatcgtcaccggcccgactgcacctggtttcctg
acaccagacctgctggcggtgctgaacgagaaattcggcctgcgttctatcaccactgtt
gaagaagacatgaagcaactgttgagcgcgtaa
              
                            

Download fasta file
RegulonDB