RegulonDB RegulonDB 10.8: Gene Sequence
ybjX gene sequence


Size: 993        A: 255  T: 242  G: 253  C: 243

Fasta

 

>ybjX E. coli K12. Version NC_000913.3 GI:556503834
atggtgaaatcgacgccatgtataaccattgatttcatgaatatgtcgcagctaactgaa
cggacctttacgccatctgaatctctcagcagcctgtcactttttcttagtctggcacgt
ggacagtgtcggccgggtaaattctggcatcgccgtagttttcgccagaaatttttgctg
cgctcgttgattatgccgcgtttaagcgttgagtggatgaacgaactttcccactggcct
aatctcaatgtattgttaacgcgccagccgcgactgcctgtgcgtctgcatcgcccttac
cttgcggcgaatcttagccgtaagcaattgctggaggcgttacgttaccattatgcgtta
ctccgcgaatgtatgtcggcggaagaattcagcttatatttgaatacccccgggctgcaa
ctggcgaagctggaaggcaaaaacggcgagcagttcacgcttgagctgaccatgatgatc
tcaatggataaagaaggtgacagcacaatcctgttccgcaacagcgaaggtattcctctg
gcagagatcacgtttaccctgtgtgaatatcaggggaaaagaacgatgtttattggcgga
ctgcaaggcgcaaaatgggaaattccacatcaggaaatccagaatgcgacgaaagcctgc
cacgggctatttcccaaacgcctcgtgatggaagcggcctgtctgtttgcccaacgtttg
caggtagagcagattattgccgtcagcaatgaaacgcatatttaccgcagcctgcgttat
cgcgataaagaaggcaagatccacgctgattacaacgctttctgggaatcggttggcggc
gtatgtgatgctgaacgccattaccgccttccagcacagatagcacgaaaagagattgcc
gaaatcgccagtaaaaaacgggctgaataccgtcggcgctatgagatgctcgacgctatt
cagccacaaatggccacgatgtttcgcggttaa
              
                            

Download fasta file
RegulonDB