RegulonDB RegulonDB 10.8: Gene Sequence
lolA gene sequence


Size: 612        A: 174  T: 126  G: 160  C: 152

Fasta

 

>lolA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaattgccatcacctgtgcattactctcaagcttagtagcaagcagcgtttgg
gctgatgccgcaagcgatctgaaaagccgcctggataaagtcagcagcttccacgccagc
ttcacacaaaaagtgactgacggtagcggcgcggcggtgcaggaaggtcagggcgatctg
tgggtgaaacgtccaaacttattcaactggcatatgacacaacctgatgaaagcattctg
gtttctgacggtaaaacactgtggttctataacccgttcgttgagcaagctacggcaacc
tggctgaaagatgccaccggtaatacgccgtttatgctgattgcccgcaaccagtccagc
gactggcagcagtacaatatcaaacagaatggcgatgactttgtcctgacgccgaaagcc
agcaatggcaatctgaagcagttcaccattaacgtgggacgtgatggcacaatccatcag
tttagcgcggtggagcaggacgatcagcgcagcagttatcaactgaaatcccagcaaaat
ggggctgtggatgcagcgaaatttaccttcaccccgccgcaaggcgtcacggtagatgat
caacgtaagtag
              
                            

Download fasta file
RegulonDB