RegulonDB RegulonDB 10.8: Gene Sequence
ycaM gene sequence


Size: 1431        A: 322  T: 434  G: 375  C: 300

Fasta

 

>ycaM E. coli K12. Version NC_000913.3 GI:556503834
atggctgggaatgttcaggaaaaacagttgcgatggtacaacattgcgctgatgtctttt
atcactgtctggggttttggcaacgttgttaataactatgccaaccaggggctggtggtt
gttttttcatgggtgtttatctttgcactctatttcacaccttatgcgctaattgttggt
cagttaggctcgaccttcaaagatgggaagggcggggtcagtacctggattaaacacacg
atgggacccggactggcttatctcgccgcgtggacctactgggtggtgcatattccctat
ctggcacaaaaaccccaggcaattctgattgcgctcggttgggcgatgaaaggcgacggt
tcgctaatcaaagaatattcagtcgtagcgttacaggggttaacgctggtgctgtttatc
ttctttatgtgggttgcttcacgcggtatgaaatcgctgaaaatcgtcggttctgtggca
gggattgctatgtttgttatgtcactcctgtatgtggcgatggcggtaaccgcgcctgca
attactgaagtgcatattgcgaccacaaacattacctgggaaacgttcattcctcatatc
gactttacctacattaccactatttcaatgctggttttcgcggttggcggagcagagaag
atttctccttacgttaatcaaacgcgcaacccaggaaaagaatttccaaaagggatgtta
tgcctggcggtgatggttgcggtttgtgccattctgggctcgctggcgatggggatgatg
tttgattcgcgtaatatcccggatgacttaatgaccaacggtcagtattacgcctttcag
aagctgggcgagtattacaacatgggtaatactttaatggtgatttacgccattgcgaat
accctgggacaagtagcggcgctggtattctcgattgatgccccgcttaaagtgctatta
ggtgatgctgacagcaaatatattccagccagtttatgtcgtaccaacgcttctggtacg
cccgttaatggctattttctgaccctggtactggtggcgattctgattatgctgccgact
ctcggcattggtgatatgaacaatctctataaatggctgttgaaccttaattcggtagtg
atgccgctgcgttatttatgggtatttgttgcatttattgcagtcgttcgcttggcgcag
aaatataaaccagaatatgtctttattcgtaataagcctctggcaatgaccgtcgggatt
tggtgttttgcctttaccgcctttgcctgtttgacggggatcttcccgaaaatggaagcc
ttcactgcagagtggaccttccagttggcgctgaatgttgcaacgccgtttgtgctggta
ggattaggactgatattcccgctgctggcgcgtaaagcgaatagtaaataa
              
                            

Download fasta file
RegulonDB