RegulonDB RegulonDB 10.10: Gene Sequence
ycaO gene sequence


Size: 1761        A: 421  T: 432  G: 467  C: 441

Fasta

 

>ycaO E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaaacatttatccccggcaaagatgccgctctggaagattccatcgctcgcttc
cagcaaaaactttcagacctcggctttcagattgaagaggcctcctggctgaatcccgtg
cctaacgtctggtctgtacatattcgcgacaaagagtgcgcactgtgttttaccaacggt
aaaggcgcaaccaagaaagcggcgctggcttctgcactcggtgaatatttcgagcgtctc
tcaaccaactacttttttgcggacttctggctgggcgaaaccatcgccaacggtccgttc
gtgcattatcccaacgaaaaatggttcccactgaccgaaaatgacgatgtgccagaaggg
ctgctcgatgaccgtctgcgcgcgttttatgatccggagaatgaactgaccggcagcatg
ctgattgacctacaatccggtaacgaagatcgtggtatttgcggcctgccgtttacgcgt
cagtccgacaatcagaccgtttatattccgatgaatatcattggtaacctgtacgtctcc
aacggtatgtccgcaggtaatacccgcaacgaagcacgcgttcagggattgtctgaagtt
ttcgaacgctacgtgaaaaaccgcattattgctgaaagcatcagcctgccagagatcccg
gcagacgtgctggcgcgttacccagcagtagttgaagccatcgaaacgctggaagcggag
ggtttcccaatcttcgcttatgacggttcgcttggcggccagtatccggtgatttgcgtg
gtactgttcaatcctgctaacggtacctgctttgcctctttcggtgcgcatcctgatttt
ggcgtagcactggaacgtaccgtgaccgagctgctgcaaggtcgtggcctgaaagatttg
gatgtgtttactccgccaaccttcgatgatgaagaagtcgctgaacataccaacctcgaa
acgcactttatcgattccagcggtttaatctcctgggacctgttcaagcaggatgccgat
tatccgtttgtggactggaatttctccggcaccacggaagaagagttcgccacactgatg
gctatcttcaacaaagaagataaagaagtttatattgccgattacgagcatctgggcgtt
tatgcttgccgtattatcgtgcctggcatgtccgatatttatccggctgaagatctgtgg
ctcgcgaataacagtatgggcagccatttacgtgaaacgattctttcgctaccaggcagc
gagtgggaaaaagaagattacctgaacctcatcgagcaactggatgaagaaggttttgat
gactttacccgcgtgcgtgagctgttgggtctggcgaccgggtcggataacggttggtac
accctgcgtatcggtgaattaaaagccatgctggcgctggctggtggcgatctggaacag
gctctggtctggaccgaatggacgatggagtttaactcatcagtatttagtccggaacgc
gccaactattatcgctgcctgcaaacgttgttattactggcacaggaagaagatcgccag
ccgctgcaatatctgaatgcgtttgttcgcatgtacggcgcagatgccgtagaagccgcc
agtgcggcaatgagcggcgaagcggcgttttacggcctgcaaccggtagatagcgatctg
cacgcgtttgctgcacatcagtcgttgttgaaggcctacgaaaagctgcagcgcgccaaa
gcagcattctgggcaaaataa
              
                            

Download fasta file
RegulonDB