RegulonDB RegulonDB 10.8: Gene Sequence
ssuA gene sequence


Size: 960        A: 237  T: 220  G: 246  C: 257

Fasta

 

>ssuA E. coli K12. Version NC_000913.3 GI:556503834
atgcgtaacatcattaaactggcgctggcgggattgcttagcgtctctacttttgcggtt
gctgcagaatcctcgcctgaagcgttacgtataggctatcagaaaggcagtattggtatg
gtgctggcaaaaagccaccagttactggaaaaacgctatccggaatcaaaaatctcctgg
gtggagttccccgcgggtccgcaaatgttggaagcgttaaacgttggcagtattgatctc
ggcagtaccggggatattccgccaatctttgcccaggctgccggggctgatttggtgtac
gtgggcgtcgagccaccgaagcccaaagccgaagtgattctggtggcagaaaacagcccg
atcaaaaccgtagccgatcttaaaggtcacaaagttgcctttcagaaaggttccagttca
cacaaccttttactgcgtgcactgcgtcaggccggacttaagtttaccgatatccaaccc
acttacctgacgcccgctgatgcccgcgccgcgttccagcaaggtaacgttgacgcctgg
gctatctgggatccctactactctgctgcattattacagggcggcgtgcgggtgctgaaa
gacggcaccgatctcaatcaaactggatcgttttatctggcagctcgtccctatgcagaa
aaaaacggcgcttttattcagggcgtactggcaacctttagtgaggccgatgcgttaacc
cgcagccagcgcgagcaaagcatcgctttactggcaaaaacgatgggcttaccggcaccg
gtgattgcctcttacttagatcatcgccctcctaccaccatcaaaccggttaacgccgag
gttgccgccttacagcagcaaacggcagatctgttttatgaaaatcgtctggtgccgaaa
aaagtcgatattcgccagcgcatctggcagcccactcaactggaaggaaaacaattatga
              
                            

Download fasta file
RegulonDB