RegulonDB RegulonDB 10.8: Gene Sequence
elfD gene sequence


Size: 702        A: 217  T: 169  G: 156  C: 160

Fasta

 

>elfD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacttgcataacaaagggaattgtgaccgtaagtttaacggcaatattactcagc
tgctcatccgcatgggcggcaggtaaaggcgggattggacttgcagcaacacgtcttgtt
tattcagaaggtgaagagcaaatttcactgggtgtacgtaacaccagtccggatgttcct
tatcttattcagtcatgggtgatgaccccagataataaaaaatcagcagactttattatt
acaccaccgctatttgtgctgaatccggcaaatgagaatctgttacgcattatgtacatt
ggagcgccgttggcgaaagacagagaaacccttttcttcactagcgtacgggcagtccct
tcaacaacgaagcggaaagagggaaataccctgaagattgccacacaaagcgtcatcaaa
cttttctggcgaccaaaaggtttagcgtatcccttaggcgaggctccggcgaaactgcgt
tgcacttcgtcagctgacatggttacggtcagtaacccaacaccttatttcattaccctg
acagacctgaaaataggtggaaaagtagttaaaaatcaaatgatttccccctttgataaa
taccaattttctctgccaaagggggccaaaaatagcagcgtaacgtatcgaaccatcaat
gactacggggcggaaacgccgcaactcaactgtaaatcgtaa
              
                            

Download fasta file
RegulonDB