RegulonDB RegulonDB 10.8: Gene Sequence
elfC gene sequence


Size: 2601        A: 706  T: 650  G: 677  C: 568

Fasta

 

>elfC E. coli K12. Version NC_000913.3 GI:556503834
atgtatagaactcatcgacaacacagcctgttaagctctggtggagtgccatcgtttatt
ggtgggctggtggtgtttgtgtcggcagcgttcaatgcacaagctgaaacctggttcgat
cctgcttttttcaaagatgatccctcaatggtggccgatttgtctcgtttcgaaaaagga
caaaaaataacgccaggggtttatcgtgtcgatattgttctgaatcagacaattgtagat
acgcgcaacgtcaattttgttgagataacgccagagaaggggattgccgcctgtttgacg
actgaaagcctggatgcaatgggtgttaatactgatgcgtttccggcttttaaacaactg
gacaaacaagcgtgtgtgccattggcggagattattccggatgccagcgtaacgtttaat
gtgaataaactccgtctggaaatttcagtaccgcaaatcgccatcaaaagtaatgcccgt
ggttatgtcccccctgaacgttgggatgaagggatcaacgcgctattactgggatattcg
tttagcggggctaacagtattcatagcagcgcagacagtgattctggcgacagctatttt
ctgaatttaaacagtggcgttaatttaggcccatggagattgcgcaacaattcaacatgg
agtcgtagtagtggccaaaccgcagaatggaagaatctcagcagctatttgcaacgggcg
gttattcctctgaaaggcgaactgaccgtaggtgatgattatactgcaggcgattttttc
gatagtgtcagctttcgtggtgtgcagctggcgtcagatgacaacatgctgccagacagc
ctgaaagggtttgcgcctgtggtgcgtggtatcgccaaaagcaatgcccagataacgatt
aagcaaaatggttacaccatttaccaaacttatgtatcgcctggtgcttttgaaattagt
gatctctattccacgtcgtcgagcggtgatttgttagttgaaatcaaagaagcggacggc
agcgtcaatagctacagcgtaccgttctccagtgtgccattactccagcgtcaggggcga
atcaaatacgcggtgacactggcgaaatacagaaccaatagtaatgaacagcaggagagc
aaatttgcccaggccacgttgcagtggggcggaccgtggggaacgacctggtatggtggt
ggacaatatgctgaatattaccgtgccgccatgtttggtctgggatttaacctcggcgat
ttcggagcaatttcgttcgatgcgacccaggcgaagagtacgctagcagatcaaagcgaa
cataaaggtcagtcatatcgttttctgtatgccaaaacgctcaaccacttgggcactaac
tttcaattgatgggctatcgctattcgacgtcgggtttctacaccctttccgacaccatg
tataaacatatggatggctacgaatttaatgacggtgatgatgaagatacgccgatgtgg
tcgcgttattacaatttgttttacaccaaacgtggcaaactgcaggtcaatatctcccag
caattaggcgagtacggttcgttttatttaagtggtagccagcaaacttactggcatacg
gatcaacaggatcggctattacagtttggctacaacacgcaaattaaagatctttcgctg
gggatttcctggaactacagtaagtcccgtggtcaacctgatgctgatcaggtgtttgct
ctaaatttttccctgccgctcaatctgttgctccccagaagtaatgatagctataccagg
aaaaaaaattacgcctggatgacctctaacaccagtatcgataacgaagggcacactaca
caaaacctgggtttaacggagacattactcgatgacggtaacctgagctacagcgtgcaa
cagggatataacagcgaggggaaaacggctaatggtagcgccagcatggattacaaaggg
gcgtttgcggatgcccgagtgggctacaactacagcgataacggcagtcaacaacaactg
aactacgctctttcaggcagtttagttgcccattcacagggcattaccctggggcaatcg
ctgggggaaactaacgttctgattgcagcaccaggcgcagagaatactcgtgtggcgaac
agcaccgggctgaaaactgactggcgcggatataccgttgttccttatgccacttcttat
cgggaaaatcgaatcgcacttgatgcggcgtcgttaaaacgtaacgtggatcttgaaaat
gcagtagtcaacgtggttcccaccaaaggggcgttggttctggcggagttcaatgcccat
gcgggtgcaagggtattaatgaaaacatcaaagcagggtataccgctgcgttttggcgcg
atagcgacgctggacggcgtacaggctaatagcggcataattgatgatgatggctcgctc
tatatggcgggtttaccggcgaagggaacaataagcgtgcgctggggcgaagctcccgat
caaatttgtcatatcaattacgagcttaccgaacaacaaattaactctgcgattacgcga
atggatgccatatgcagataa
              
                            

Download fasta file
RegulonDB