RegulonDB RegulonDB 10.8: Gene Sequence
ycbU gene sequence


Size: 543        A: 143  T: 144  G: 136  C: 120

Fasta

 

>ycbU E. coli K12. Version NC_000913.3 GI:556503834
atgaagaaaaaaacgatatttcagtgcgttatcttgttctttagcattcttaacatccat
gtcgggatggctgggcctgaacaagttagtatgcatatttatgggaatgtggtcgatcag
ggctgtgatgtcgccaccaaaagtgcattacaaaatattcatattggtgattttaatatc
agtgattttcaggccgcgaataccgtaagcactgctgctgatttgaatatcgatatcacc
ggttgtgccgctggtattactggcgcggacgtcctttttagcggcgaggctgacaccctt
gcgccgacactgctcaaactaactgacacaggcggaagcggtggtatggcaacggggatt
gccgtgcaaattcttgatgcgcaaagtcagcaagaaatcccgctcaatcaggtccagcct
cttacgcccttaaaagccggggataacacactcaaatatcaacttcgttataagtccaca
aaggcgggagcaacgggcggtaatgcgacggcggttctctattttgatctggtttaccag
tga
              
                            

Download fasta file
RegulonDB