RegulonDB RegulonDB 10.8: Gene Sequence
rlmL gene sequence


Size: 2109        A: 501  T: 464  G: 603  C: 541

Fasta

 

>rlmL E. coli K12. Version NC_000913.3 GI:556503834
atgaattctctgtttgccagtacggcccgtgggctggaagagctgttaaaaactgaactg
gaaaacctgggggccgttgaatgccaggtggttcagggtggggtccatttcaagggcgac
acacggcttgtttaccagagcctgatgtggagccgcctggcctcgcgtattatgttgccg
ctgggcgagtgtaaggtttacagcgatttagacctctatctcggtgttcaggcgatcaac
tggacagagatgtttaatcctggcgcgaccttcgctgtccacttcagtggtttgaatgac
accatccgcaacagtcagtacggcgcgatgaaagtgaaagacgcgatcgtcgatgctttc
acgcggaaaaatctgccgcgtccaaatgttgatcgcgatgcgccggatatccgcgttaac
gtctggctgcataaagaaaccgccagtatcgctcttgatctgagtggtgatggtttacat
ctgcgtggctatcgcgatcgtgctggtattgcgccgatcaaagaaaccctggcagccgct
attgtgatgcgatccggctggcagccaggaacaccgctgctcgatccgatgtgtggttcc
ggtacgttgctgattgaagcagcgatgctggcgaccgatcgcgcaccaggcttgcaccgt
gggcgttggggctttagcggctgggcgcagcatgatgaagctatctggcaggaagtgaaa
gcggaagcgcaaactcgcgcccgtaaaggcctggctgagtatagctctcatttttacggt
tcggacagcgacgcacgggtgattcaacgtgcacgcactaacgcccgtcttgcggggatt
ggtgaactgatcacctttgaggtgaaagatgtcgcgcaactgaccaatccgctgccgaaa
gggccgtacggcacagtgttgagcaacccgccatacggggaacgtctggacagcgaaccg
gcgctgattgcgctgcatagcctgctgggtcggatcatgaaaaaccagtttggtggctgg
aatctctctttgtttagtgcctcgccggatctgctaagctgcttgcagctgcgtgcagac
aaacagtacaaggcgaaaaacggcccgctggactgcgtacagaaaaattaccacgttgcc
gaaagcactccagacagcaaaccggcgatggtagcggaagactacaccaaccgcctgcgt
aagaacctcaaaaaattcgagaagtgggctcgccaggaagggattgaatgttaccgcctg
tatgacgccgatctgccagaatataacgttgccgttgaccgttatgccgactgggtggtg
gtgcaggagtatgcgccgccaaaaactattgatgctcacaaagcgcgtcagcgtctgttc
gatattatcgctgcaaccatttcggtactggggattgcgccaaacaaactggtgctgaaa
acccgtgaacgccagaagggcaaaaaccaataccagaaactgggcgagaagggcgagttt
cttgaagttaccgaatataacgctcacttgtgggtgaacctgacggattatctcgatact
ggtctgttcctcgatcaccgcatcgcccgtcgtatgctcggtcagatgagcaaaggcaaa
gatttcctcaacctgttctcttataccggcagcgccaccgtgcatgcgggattaggcggt
gcacgcagcaccaccaccgtggatatgtcgcgtacttatctggaatgggcagaacgcaac
ctgcgtctgaatggcctgaccgggcgtgcgcatcgcctgattcaggccgattgcctggcg
tggctgcgtgaggcaaatgaacagttcgatctgatctttatcgatccgccaaccttctct
aactcaaaacgaatggaagatgcgtttgatgttcagcgcgatcatctggcgctgatgaaa
gatttgaaacgtctgctgcgtgcaggtgggacgatcatgttctcgaacaacaaacgtggc
ttccgtatggatctcgacggcctggcaaaactgggactgaaagcacaagaaattacgcaa
aaaacgctctcccaggatttcgcccgtaaccgccagatccacaactgctggctgattacc
gcagcctga
              
                            

Download fasta file
RegulonDB