RegulonDB RegulonDB 11.1: Gene Sequence
yccT gene sequence


Size: 663        A: 159  T: 168  G: 164  C: 172

Fasta

 

>yccT E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaccggcatcgtgaccaccttgattgcattatgtttgccggtatccgtttttgcc
accacgctgcggctttcaaccgatgtcgatcttctggtactcgacggcaagaaggtttcc
agctctctgctgcgcggtgcggacagcattgaactggataatggaccgcatcagttagtg
tttcgcgttgagaagacgattcatctttccaatagtgaagaacggctgtatatctcccca
ccgctggtggtcagttttaatacccagctcatcaaccaggtcaattttcgcctgcctcgc
ctggagaatgagcgggaagctaaccattttgatgccgcgccgcgccttgaattgttggat
ggcgatgcgacgccgattccggtaaagctggatattctcgccattacctcaacggcaaaa
acgattgattatgaggtcgaggttgaacgctataacaaatccgcgaaacgcgcttcacta
ccgcaatttgccacgatgatggcagatgacagtacgctgctttcgggtgtttccgagctg
gatgctattccaccgcagtctcaggtgctcacagaacaacggctgaagtattggtttaaa
ctggctgacccacaaacgcgaaatactttcctgcagtgggcggaaaaacaaccatcttcc
tga
              
                            

Download fasta file
RegulonDB