RegulonDB RegulonDB 10.8: Gene Sequence
gfcA gene sequence


Size: 306        A: 69  T: 61  G: 85  C: 91

Fasta

 

>gfcA E. coli K12. Version NC_000913.3 GI:556503834
atgaaacacaagctttctgcaatccttatggccttcatgttgacgacgccagctgcgttt
gctgcccctgaagcaacaaacgggaccgaggcaacgacgggtactactggcaccacaacg
accactaccggcgcaaccacgactgctactaccactggtggcgtggctgctggcgctgtc
ggcacggcgacagttgtcggtgtggcaacggctgttggtgtggcgacgttggcagttgtt
gcagcaaatgacagtggcgatggcggttctcataacacctcaaccaccacgtccactaca
cgctaa
              
                            

Download fasta file
RegulonDB