RegulonDB RegulonDB 10.10: Gene Sequence
rutG gene sequence


Size: 1329        A: 239  T: 372  G: 418  C: 300

Fasta

 

>rutG E. coli K12. Version NC_000913.3 GI:556503834
atggcaatgttcggttttcctcactggcagttaaaatcgacctctacagagagcggcgtg
gtcgcgccggatgaacgattgccgtttgctcagacggcagtaatgggcgttcaacacgcg
gtggcgatgtttggcgcgacggtgttaatgccgattctgatggggctggatcccaatctt
tccattttaatgtcggggatcggcacgttactgtttttctttattaccggcgggcgcgtc
cccagttatctcggctccagcgcggcttttgtcggcgtggtgatcgccgcgacgggcttt
aacggtcagggcattaacccgaatatcagcattgcgctgggcgggattatcgcctgtggg
ctggtttataccgtcattggcctggtggtgatgaaaatcggtacgcgctggattgaacga
ctgatgccgccggtggtgacgggtgcggtggtgatggcgattggcctgaacttagcgcct
atcgcagtgaaaagtgtatcggcttcggcctttgatagctggatggcggtaatgacggtg
ctgtgtattgggctggtggcggtgtttacccgtggcatgatccagcggttattgattctc
gtaggattaattgtcgcctgtctgctgtatggcgtgatgaccaacgttttagggctggga
aaagccgtcgattttactctcgtcagccatgctgcctggttcggtctgccacatttttcc
actcctgcttttaatggtcaggcaatgatgctgattgcgcccgtggcggtgattctggtg
gcggaaaacttaggtcatctcaaggcagtcgccgggatgaccggacgcaatatggacccg
tatatggggcgggcattcgtaggcgatggtctggcaacgatgctttccggctctgtcggc
ggtagcggcgtgaccacctatgctgaaaatatcggtgtgatggccgtgaccaaagtctac
tcgacgctggtgtttgttgctgctgccgtcatcgccatgctgttgggcttttcaccgaaa
tttggtgcgctgattcataccattccggccgcggttattggtggtgcatcaattgttgtg
ttcgggctgattgccgtcgcaggcgcaaggatatgggtacaaaaccgtgtcgatttaagc
cagaacggtaatttgattatggtcgcagtaaccttagtgctgggcgcgggtgattttgct
ctcacgctgggcggttttacgttgggagggattggtacagcaacctttggcgcgatttta
ctcaatgcgttgttaagcagaaagttggttgacgttccaccgccagaagttgttcatcag
gagccataa
              
                            

Download fasta file
RegulonDB