RegulonDB RegulonDB 10.8: Gene Sequence
rutF gene sequence


Size: 495        A: 95  T: 108  G: 144  C: 148

Fasta

 

>rutF E. coli K12. Version NC_000913.3 GI:556503834
atgaacattgtcgatcaacaaacttttcgcgatgcgatgtcctgcatgggcgcggcggtc
aatattatcaccacggacggtccagccgggcgcgccgggttcaccgccagcgccgtctgc
agtgtgaccgatacgccgcccacattactggtgtgcctgaatcgtggggcgtccgtctgg
ccggcattcaatgaaaatcgaacgctgtgtgtaaatacacttagcgccgggcaggagccg
ctttcaaacctttttggcggcaaaacgcccatggaacaccgctttgccgccgcccgctgg
cagacgggggtgaccggatgcccgcaactggaagaggctctggtttcgtttgactgccgt
atcagccaggtggtgagcgtcggcacccacgacattctgttttgcgccatcgaagcgatt
catcgtcacaccacaccctacgggctggtgtggttcgatcgcagttatcacgcgctgatg
cgccctgcttgttaa
              
                            

Download fasta file
RegulonDB