RegulonDB RegulonDB 11.0: Gene Sequence
rutB gene sequence


Size: 693        A: 151  T: 158  G: 189  C: 195

Fasta

 

>rutB E. coli K12. Version NC_000913.3 GI:556503834
atgacgaccttaaccgctcgaccggaagccattaccttcgatccgcagcaaagtgcgctg
atcgtggtggatatgcaaaacgcttatgccacgccaggcggctacttagatctcgccggg
tttgatgtctcaaccactcgcccggtcattgccaacattcaaaccgccgtgaccgcagcg
cgagcggcagggatgctgatcatctggtttcaaaatggctgggatgaacagtatgtcgag
gctggcggacccggctcaccgaattttcataaatcgaacgccctgaaaaccatgcgtaag
cagccgcagctgcaggggaaattgctggcgaaaggctcctgggattatcaactggtggat
gaactggtgccgcagcctggcgatattgtgctgccgaagccgcgctacagcggtttcttc
aatacgccgctggacagcattttgcgcagccgcggaatacgccatctggttttcaccggc
atcgctaccaacgtctgcgtcgaatcgacgctacgcgacggcttttttctggagtatttc
ggcgtggtgcttgaagacgcaactcaccaggcggggccgaaatttgcgcagaaagccgcg
ttgttcaatatcgaaaccttttttggctgggtcagcgacgtcgaaacattctgcgacgcg
ctttctcccacgtcctttgctcatatcgcttaa
              
                            

Download fasta file
RegulonDB