RegulonDB RegulonDB 10.10: Gene Sequence
efeU gene sequence


Size: 830        A: 147  T: 233  G: 251  C: 199

Fasta

 

>efeU E. coli K12. Version NC_000913.3 GI:556503834
atgtttgttccgtttctcattatgttgcgcgaaggacttgaagccgcgctgattgtcagt
ttgattgccagctatcttaagcgtacccagcgaggccgatggattgtgtgatgtggattg
gcgtgttgcttgccgctgcgttgtgcctgggcttgggtatcttcattaacgaaaccaccg
gcgaatttccgcaaaaagaacaggaactgtttgaaggtatcgtggcggtgatcgccgtgg
tgatccttacctggatggttttctggatgcgcaaagtgtcgcgcaacgtcaaagtgcaac
tggaacaggcagtcgatagcgcattgcagcgtggaaatcatcatggctgggcgctggtga
tgatggtcttttttgccgttgcaagggaagggctggagtcggtctttttcctgctggcgg
catttcaacaagatgtcgggatctggccgccgctgggtgcaatgctcggtcttgctactg
ccgtggtgctaggcttcctgctctactggggcggtattcgcctcaatcttggtgcatttt
ttaaatggaccagcctgtttattctcttcgtcgccgcagggctggcagctggtgccattc
gcgcatttcatgaagccggattgtggaaccactttcaggaaatcgccttcgatatgagtg
cggtgctctcaactcactcgctgtttggcacgctgatggaagggatttttggctatcagg
aagcgccgagcgtcagcgaagtcgccgtctggtttatttatctcatcccggcgctggtgg
catttgctctgccaccacgcgcaggggcgacagcgtctcgctccgcgtaa
              
                            

Download fasta file
RegulonDB