RegulonDB RegulonDB 11.1: Gene Sequence
efeO gene sequence


Size: 1128        A: 315  T: 234  G: 310  C: 269

Fasta

 

>efeO E. coli K12. Version NC_000913.3 GI:556503834
atgaccattaacttccgccgtaacgcattgcagttgagcgtggctgcgctgttttcttct
gcttttatggctaacgccgctgatgtgccgcaggtcaaagtgaccgtgacggataagcag
tgcgaaccgatgaccattacggttaacgccgggaaaacacagttcattattcagaaccac
agccagaaggcgctggagtgggagatcctcaaaggcgtgatggtggtggaagagcgggaa
aatatcgcccctggctttagccagaaaatgacggcgaatttacagcctggcgaatacgat
atgacctgcggtctgctgactaacccgaaagggaagttgatcgtcaaaggtgaggcaacg
gcggatgcggcgcaaagtgatgcgctgttaagtcttggtggtgcaattactgcatataaa
gcgtatgtcatggcggaaaccacgcagctggtgaccgacaccaaagcctttaccgacgcg
attaaagcaggcgatatcgaaaaagcgaaagcactgtatgcaccgacgcgccagcactat
gagcgtattgaaccgattgctgaactgttctccgatctggatggcagcattgacgcccgt
gaagatgattacgagcaaaaagccgccgacccaaaattcactggtttccaccgtctggaa
aaagcattgtttggcgacaacaccaccaaagggatggatcagtacgctgagcagctttat
accgatgtggtcgatttgcaaaaacgcatcagtgaactggctttcccaccttcaaaagtg
gtcggcggcgcagccggactgattgaggaagtggcagccagcaaaattagcggtgaagaa
gatcgctacagccacaccgatctgtgggatttccaggctaacgttgaaggctcgcagaaa
attgtcgatttgctgcgtccacaactgcaaaaagccaacccggaactgctggcaaaagtc
gatgccaactttaaaaaggtcgataccattctggcgaaataccgtactaaagacggtttt
gaaacctacgacaaattgaccgatgccgaccggaatgcactgaaaggaccgattactgcg
ctggcggaagatctggcgcaacttcgcggtgtgctgggactggattaa
              
                            

Download fasta file
RegulonDB