RegulonDB RegulonDB 10.7: Gene Sequence
pgaD gene sequence


Size: 414        A: 121  T: 110  G: 91  C: 92

Fasta

 

>pgaD E. coli K12. Version NC_000913.3 GI:556503834
atgaacaatttaattattacgacccgacaatcaccagtacgtttactggttgattatgtt
gccacaaccatcttgtggacattatttgcgttgttcatattcttattcgccatggatctg
ctgacgggttattactggcaaagcgaggccagaagccgacttcagttctattttttgctg
gcagtggcgaatgccgtcgtgttaattgtctgggcgctgtacaataagctgcgttttcaa
aaacagcagcatcatgcagcctaccaatatacgccgcaagaatatgcagagagcttagca
atacctgatgagctctatcagcaactacaaaaaagccacaggatgagcgtacacttcacc
agccaggggcaaataaaaatggttgtttcagaaaaagcgctagtccgggcataa
              
                            

Download fasta file
RegulonDB