RegulonDB RegulonDB 10.9: Gene Sequence
dgcT gene sequence


Size: 1359        A: 383  T: 452  G: 306  C: 218

Fasta

 

>dgcT E. coli K12. Version NC_000913.3 GI:556503834
atggaaaaagactatttgagaattagtagtactgtattagtgagcttattgtttgggctt
gctttggttttggtgaatagttggtttaatcagccaggcgttgaggaagttgttccacga
tcaacctatctgatggtaatgattgctttattttttatcgatactgttgcatttattttt
atgcagttgtatttcatttatgaccgtaggcaattttcaaactgtgtacttagtttggct
tttctgagttgtttgatttactttgttataaccgtcattatcattcagcaaattattgag
gagcgtttgacaagcagtgttgtccaaaatgacattgcaatctattatttgtttcgtcag
atgagtttgtgcatattaatatttctggcattggtgaataaagttagtgaaaacacaaaa
cagcgcaatttattttccaaaaaaatgactttgtgcataagtttgttttttgtttttggg
gggccgatagttgctcacatactttctagtcattatgagagctacaatttacacattgcc
gagttaaccaatgaaaatggtcaggtggtttggaaagcctcatatgttaccataatgatt
ttcatgtggttaaccttgctttcggttaatctatactttaatggtttacgctatgatatc
tggaatggagtgacggtgattgctttttgtgccgtactgtacaatatctctctgttattt
atgagcaggtatagcgtgtccacttggtatattagtcgcactattgaagtagtcagtaag
ttaaccgttatggtaatatttatgtgccatatattcagtgcgctacgagtaacaaagaac
attgcacatcgcgatcccttaaccaatatatttaacagaaattatttttttaatgaactg
acagttcaatcagcatcagcccaaaaaacgccttattgcgtcatgattatggatatcgac
cacttcaaaaaagtcaacgacacctgggggcatccggttggcgatcaggtgataaaaaca
gtggtgaatatcattgggaaaagcatacgaccagatgaccttttagcgcgcgtcggcggc
gaagagtttggcgtcttgctgacggacatcgatactgaacgtgcgaaagctttagcggaa
aggattcgggaaaatgttgagcgtttaactggcgataatcctgaatacgctataccacaa
aaagtgacgattagtattggcgctgttgtgactcaggaaaatgcgttaaacccaaatgag
atctatcgactggctgataacgcactttacgaggcgaaagagaccgggcgtaataaggtg
gttgtgagggatgtggtgaatttttgtgagtcaccataa
              
                            

Download fasta file
RegulonDB