RegulonDB RegulonDB 10.10: Gene Sequence
ycdZ gene sequence


Size: 492        A: 96  T: 131  G: 151  C: 114

Fasta

 

>ycdZ E. coli K12. Version NC_000913.3 GI:556503834
atgaacatacttctctctattgcaatcacaacaggcattctctccggtatctggggatgg
gtggctgtttccctgggcttactaagctgggcgggcttcctgggctgtacggcctacttt
gcctgcccgcaaggtgggctgaaagggctggcgatctccgctgcaaccctgcttagtggc
gtggtgtgggcgatggtcattatttacggtagtgcactggcaccacatctggaaattctc
ggttatgtcataaccggtattgtcgcgtttctgatgtgtattcaggccaaacagctgctg
ctttcatttgttccggggacgtttataggcgcatgcgcgacgtttgccgggcagggtgac
tggaaactggtgttaccttcgctggcgcttgggctgatatttggttacgcaatgaaaaac
agtggcctgtggctggcggcgcgtagtgcaaagacggcgcaccgtgagcaggaaatcaaa
aataaagcgtga
              
                            

Download fasta file
RegulonDB