RegulonDB RegulonDB 10.10: Gene Sequence
csgB gene sequence


Size: 456        A: 146  T: 119  G: 113  C: 78

Fasta

 

>csgB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagcc
gcagcaggttatgatttagctaattcagaatataacttcgcggtaaatgaattgagtaag
tcttcatttaatcaggcagccataattggtcaagctgggactaataatagtgctcagtta
cggcagggaggctcaaaacttttggcggttgttgcgcaagaaggtagtagcaaccgggca
aagattgaccagacaggagattataaccttgcatatattgatcaggcgggcagtgccaac
gatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttct
ggtaataaagcaaatattacacagtatggtactcaaaaaacggcaattgtagtgcagaga
cagtcgcaaatggctattcgcgtgacacaacgttaa
              
                            

Download fasta file
RegulonDB