RegulonDB RegulonDB 10.8: Gene Sequence
yceJ gene sequence


Size: 567        A: 114  T: 163  G: 144  C: 146

Fasta

 

>yceJ E. coli K12. Version NC_000913.3 GI:556503834
atgtcattcacaaatacccctgaacgctatggtgttatatctgcggccttccattggcta
agcgcaattattgtctacggcatgtttgctttaggtctgtggatggtcacgctcagttat
tacgatggctggtatcacaaagcacccgaactgcataaaagcatcggtattttgttaatg
atggggctggttattcgcgttctgtggcgtgtcatatctccaccgccgggtccgctgccg
agttattcgcccatgactcgtcttgccgcaagagctggacatctcgcattgtacctattg
cttttcgccatcggcatcagcggctatctgatctcaactgccgatggtaaaccgatcagc
gtttttggctggtttgacgtccccgcgacccttgccgacgctggcgcacaggcagacttt
gccggtgccctgcatttttggctcgcgtggagcgtcgtagtactgtccgttatgcacgga
tttatggccctgaagcatcatttcatcgataaagacgacactctgaagcgcatgctggga
aagtcgtcatctgactatggagtataa
              
                            

Download fasta file
RegulonDB