RegulonDB RegulonDB 10.8: Gene Sequence
ycfT gene sequence


Size: 1074        A: 207  T: 335  G: 264  C: 268

Fasta

 

>ycfT E. coli K12. Version NC_000913.3 GI:556503834
atgaaacaaaaagagctatggattaaccagatcaaagggttatgtatttgtctggtggtg
atttatcactcggtcattaccttttatccgcatctgaccacttttcagcatccgttatcg
gaagtcctgagcaaatgctggatctatttcaatctttaccttgccccctttcgtatgccg
gtttttttctttatatccggctatttgattcgccgctatatcgacagcgtaccgtgggga
aattgtctcgataaacggatctggaacatcttctgggtgctggcgctttggggcgtggtg
cagtggctggcgttaagtgcgctgaaccagtggctggcacctgagcgcgatttaagcaat
gcctccaatgccgcttatgccgattccaccggtgagttcctgcacgggatgatcaccgcc
agcaccagcttgtggtatctgtatgcgttaattgtctatttcgtggtatgtaaaattttt
agccgtctggcgctgccactattcgccttgtttgtactgctgagtgtggcggttaatttc
gttcccacgccgtggtggggaatgaacagtgtgatccgcaatttgccttattacagcctt
ggcgcatggtttggcgcaacaataatgacctgtgttaaagaggtgccgttgcgccgccat
ctgctgatggcttctttgcttaccgttctggcggtcggtgcctggttgtttactatctcg
ctgctgttgtcgctggtatcgattgtggtgatcatgaagctgttttatcaatacgagcaa
cgattcggtatgcgctccaccagcctgctgaatgtgattggctccaacaccattgctatc
tacaccacccatcgcattctggttgaaatattcagcttaactctgcttgcgcaaatgaac
gcagcacgctggtcgccgcaagtcgaactgacactcctgctggtttatccctttgtcagt
ttgttcatctgtactgttgcgggcttgctggtaagaaaactttcacagcgtgcattcagc
gatctgttgttctccccgccttcactgcccgctgccgtcagttactcccgctaa
              
                            

Download fasta file
RegulonDB