RegulonDB RegulonDB 10.8: Gene Sequence
emtA gene sequence


Size: 612        A: 155  T: 139  G: 178  C: 140

Fasta

 

>emtA E. coli K12. Version NC_000913.3 GI:556503834
gtgaaattgagatggtttgcctttttgattgtgttattagcgggttgttcatcaaagcat
gactatacgaacccgccgtggaacgcgaaagttccggtgcaacgtgcgatgcagtggatg
ccaataagccagaaagccggtgcagcctggggcgtcgatccacaattgatcacggcgatt
atcgctatcgaatcgggtggtaatccgaacgcggtgagtaaatcgaatgccattggtttg
atgcagttaaaagcttcaacctccggacgtgatgtttatcgccgtatgggctggagtggt
gagccgacgaccagcgagctgaaaaatccagagcgtaatatttcaatgggggcggcttac
ctgaatattctggaaaccggcccgctggcaggcattgaagatccgaaggtactgcaatat
gcgctggtggtgtcatacgctaacggggcaggtgcgctgctacggactttctcgtcagat
cggaaaaaggcgatcagcaaaatcaacgatttggatgctgacgagttcctcgaacacgta
gcgcgaaatcaccctgcgccgcaggctccgcgctatatctacaaacttgagcaggcactg
gacgcgatgtaa
              
                            

Download fasta file
RegulonDB