RegulonDB RegulonDB 10.9: Gene Sequence
dhaL gene sequence


Size: 633        A: 152  T: 142  G: 180  C: 159

Fasta

 

>dhaL E. coli K12. Version NC_000913.3 GI:556503834
atgtcactgagcagaactcaaattgttaactggctcactcgttgtggcgatattttcagc
accgagagcgagtatcttaccggactggatcgcgaaattggcgatgctgaccacgggcta
aatatgaaccgaggctttagcaaagtggtggaaaaactccctgctatcgcagataaagat
atcggtttcattctcaagaataccggtatgacgctgctttccagcgtcggtggtgccagt
ggtccgctgttcggtaccttctttatccgcgccgcacaggcgacccaggcacggcaaagc
ctgacactggaagagctttatcagatgttccgcgatggcgcggacggcgtaatcagtcgc
gggaaagccgaacctggcgataaaaccatgtgtgatgtgtgggtgccggtggtggaatcg
ttacgtcagtccagcgagcaaaatctctctgttccggtggcgctcgaagctgccagtagc
atcgccgaatccgctgcacaaagtacgattacgatgcaagcccgcaaaggccgcgccagt
tatctcggtgaacgcagtattggtcaccaggatcccggcgcgacctcggtgatgtttatg
atgcaaatgttggcgttagccgcaaaagagtaa
              
                            

Download fasta file
RegulonDB