RegulonDB RegulonDB 10.8: Gene Sequence
dhaK gene sequence


Size: 1071        A: 258  T: 245  G: 290  C: 278

Fasta

 

>dhaK E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaattgatcaatgatgtgcaagacgtactggacgaacaactggcaggactggcg
aaagcgcatccatcgctgacactgcatcaggatccggtgtatgtcacccgagctgatgcc
cctgttgcaggaaaagtcgccctgctgtcgggtggcggcagcggacacgagccgatgcac
tgtggttatatcggtcaggggatgctttcgggggcctgtccgggcgaaattttcacctca
ccgacgcccgataaaatctttgaatgcgccatgcaagttgatggcggcgaaggtgtactg
ttgattatcaaaaattacaccggcgatattcttaactttgaaacagcgaccgagttactg
cacgatagcggcgtaaaagtgaccactgtggtcattgatgacgacgttgcggtaaaagac
agtctttatactgccgggcgacgcggcgttgccaacaccgtattaattgaaaaactcgta
ggcgcagcggcggagcgtggcgactcactggacgcctgtgcggaactggggcgtaagctg
aataatcaaggccactcaataggtatcgctctcggtgcctgtaccgttcctgccgcgggc
aaaccttcttttaccctggcggataatgagatggagtttggcgtcggcattcatggtgag
ccgggtattgaccgccgccccttctcttcccttgatcaaaccgtcgatgaaatgttcgac
accctgctggtaaatggctcataccatcgcactttgcgtttctgggattatcaacaaggc
agttggcaggaagaacaacaaaccaaacaaccgctccagtctggcgatcgggtgattgcg
ctggttaacaatcttggcgcaactccgctttctgagctgtacggcgtctataaccgcctg
accacacgttgccagcaagcgggattgactatcgaacgtaatttaattggcgcgtactgc
acctcactggatatgaccggtttctcaatcaccttactgaaagttgatgacgaaacgctg
gcactctgggacgccccggtccacaccccggcccttaactggggtaaataa
              
                            

Download fasta file
RegulonDB