RegulonDB RegulonDB 10.8: Gene Sequence
dhaR gene sequence


Size: 1920        A: 471  T: 461  G: 533  C: 455

Fasta

 

>dhaR E. coli K12. Version NC_000913.3 GI:556503834
atgagtggcgcttttaacaacgatggtcggggcatatctcccttaattgcaacctcctgg
gagcgatgcaataagctgatgaaacgggagacatggaacgtaccacatcaggcccagggc
gtgacatttgcttctatttatcggcgtaagaaagcgatgctgacgctcgggcaggctgcg
ctggaagatgcctgggaatatatggcaccgcgagagtgtgcgctgtttatcctcgatgaa
accgcctgcattctcagccgtaatggcgatccgcaaaccttgcagcagctaagtgcactg
ggattcaatgacggcacgtattgcgccgagggaattattggtacttgtgcgctatcgtta
gcggctatctctggtcaggccgtgaaaacgatggccgatcaacatttcaaacaggtactc
tggaactgggccttttgtgcaacgccgttgtttgacagcaagggccgattgacgggaaca
atagcgctggcgtgtccggttgagcaaactaccgcagctgatttgccgttgacgttggca
atcgcccgcgaggtcggaaatttactgctgacggacagtttgctcgctgaaactaaccgt
catttaaatcaacttaatgccctgttagaaagtatggatgatggcgtgattagctgggac
gagcagggtaatttgcaatttattaatgcccaggcggcgcgggtcttgcgccttgacgcg
acggcaagtcagggacgggcaatcactgaactcttaacgttacccgccgtattgcaacaa
gcaataaaacaggcacatccgctcaaacacgtagaagcaacctttgaaagccagcaccag
tttattgatgcggtgataacccttaaaccgataatagaaacgcagggaaccagctttatt
ttgttgctccatcctgtggaacagatgcggcagttgatgaccagtcaattaggaaaagtc
agccataccttcgctcatatgccacaggacgatccgcaaacccgccgcttgattcatttt
ggtcgccaggcggcgcgcagtagctttcctgtcctgctttgtggagaagagggcgtgggc
aaggcactgctaagtcaggcaattcataatgaaagcgagcgtgctgcaggtccttatatc
gccgtcaattgtgagttatatggtgatgctgcgctggcggaagaatttattggtggcgat
cgcacggacaatgaaaatggccgtctgagtcggctggaactggcacacggcggcacgctg
tttcttgaaaagattgaatatctggcggtggagttacagtctgctttgcttcaggttatc
aagcagggggttatcacgcgactggatgcgcggcgtttaataccaattgatgtcaaagtg
attgcaacaacgaccgcggacctcgcaatgctggtggaacaaaatcgttttagtcgccag
ctgtattacgcgctgcatgcatttgaaattaccatcccgcctctgcgtatgcggcgtggc
agcattccggcgctggtgaataacaaattacgcagtcttgaaaaacgcttctctacgcgg
ctgaaaattgatgacgatgccctcgctcgcctggtttcttgtgcatggccaggcaacgat
tttgaactttacagcgtcatcgagaatcttgctctgagtagtgataacgggcgcattcgc
gtcagtgatttgccggaacatctgtttaccgagcaggcgacagatgatgtcagcgccacc
cgcctttccaccagtctgtcatttgcggaagttgaaaaagaggcaattattaacgcagcc
caggtcacaggcggtcgcattcaggaaatgtcggctttacttgggatcggccgcactacg
ctgtggcggaaaatgaagcaacatggcattgatgcagggcagtttaagcgccgggtatga
              
                            

Download fasta file
RegulonDB