RegulonDB RegulonDB 10.8: Gene Sequence
puuP gene sequence


Size: 1386        A: 254  T: 393  G: 383  C: 356

Fasta

 

>puuP E. coli K12. Version NC_000913.3 GI:556503834
atggctattaattcaccactgaatattgctgcgcaacccggcaaaacccgtctgcgaaaa
tcactgaaattgtggcaggtggtgatgatgggtctggcctatctcacgccgatgaccgta
tttgatacttttggtattgtctccggcattagcgacggtcacgttccggcgtcctatttg
ctggcgctggcgggtgtgctgtttaccgctatcagctacggcaaactggttcgccagttt
ccggaggccggttcggcctatacctacgcgcaaaagtcgattaacccgcacgtcggattt
atggtcggctggtcatcgctgctggattatctctttttgccgatgattaacgtcttgttg
gcgaaaatctatctctccgccctcttcccggaagtgccgccgtgggtgtgggtggtaacc
ttcgtcgccattttaaccgccgcgaatctgaagagcgtcaacctggtcgctaacttcaat
accctgtttgtactggtgcaaatctccatcatggtggtgtttatcttcctggtagttcag
ggactgcataaaggagaaggcgttggcaccgtctggtcacttcagccgtttatcagcgag
aacgcgcacctgatcccgattattaccggggcgacgattgtctgtttctccttcctcggt
ttcgatgcggtgaccacgctttcggaagagacgccggacgccgcacgcgtgatcccgaaa
gccatcttcctgacggcggtctacggtggcgttatctttatcgcggcgtcgttctttatg
cagctgttctttcccgatatcagccgctttaaagatccggatgccgcactgcctgaaatt
gcgctgtacgtcggcggcaagctcttccagtcgattttcctctgcaccacgtttgtgaac
acgttagcctctggcctggcttcacatgccagcgtgtcgcgtctgctgtatgtgatgggg
cgtgacaatgtgtttccggagcgcgtgtttggctatgtgcacccaaaatggcggactccg
gcactcaacgtcattatggtcgggattgtcgcgttgtcggcgctgttcttcgatttagtt
accgccacagcgttaattaacttcggtgctctggtggcgtttaccttcgtgaatctgtcg
gtgtttaatcatttctggcggcgtaaaggaatgaataaaagctggaaggatcacttccac
tatttgctgatgccgctggttggcgcgctgacggtgggtgtgctgtgggttaacctcgag
tcaacgtcactgacactcggtctggtatgggcttcgttaggcggcgcatatttatggtat
ctgatccgccgctatcgcaaagtgccgttgtatgatggtgacagaacgccggtgagtgaa
acgtaa
              
                            

Download fasta file
RegulonDB