RegulonDB RegulonDB 10.7: Gene Sequence
ycjG gene sequence


Size: 966        A: 216  T: 222  G: 306  C: 222

Fasta

 

>ycjG E. coli K12. Version NC_000913.3 GI:556503834
atgagaaccgttaaggtattcgaggaagcctggcccttacataccccgtttgtgattgcc
cggggaagtcgcagtgaagcgcgcgtggtggtggttgaactggaagaagagggtattaaa
ggcaccggcgaatgcacgccgtatccgcgttatggggaaagtgatgcctcggtaatggcg
caaattatgagcgtcgtgccgcaactagagaaagggctgacacgggaggagttgcaaaaa
attctccctgccggcgcagcacgtaatgcgctggattgtgcattgtgggatctggccgcg
cgaagacagcagcaatcgctggctgatttgatcggcataacgcttcccgagacagttatc
actgcacagacggttgtcatcggtacgcctgatcagatggccaatagtgcatcaacactc
tggcaggcaggcgcgaaattactgaaagtgaagctggataaccatcttatcagtgagcgg
atggtggcaattcgcacagctgtgcccgatgcgacgctgatcgttgatgcaaatgaatcc
tggcgtgcagaagggttggcggcgcgttgccagctattggcggatttaggcgttgcgatg
cttgaacaaccgcttcctgcgcaggacgatgcggcgctggagaattttattcatccgttg
ccgatttgtgctgatgaaagttgtcatactcgtagcaatttgaaggcgctgaaagggcgc
tatgagatggttaatattaagctcgataaaaccgggggtctgacggaagcgctggcgctg
gcgactgaagcgcgtgcacaaggtttcagtctgatgctgggctgcatgttgtgtacctct
cgtgccattagcgccgctttaccgctggtgccgcaggtcagtttcgccgatcttgacgga
ccgacctggctggcggtagatgtggaaccggcgcttcagttcacgacgggcgaattgcat
ctttag
              
                            

Download fasta file
RegulonDB