RegulonDB RegulonDB 10.7: Gene Sequence
mpaA gene sequence


Size: 729        A: 155  T: 174  G: 196  C: 204

Fasta

 

>mpaA E. coli K12. Version NC_000913.3 GI:556503834
atgaccgtaacccgcccacgcgccgaacgcggcgcatttccgcccggaacagaacattac
ggacgttcattattgggcgcgccgttaatctggtttcctgcccctgcagccagccgcgaa
agtggtttgattctggctggcactcacggtgatgaaaactcttcggtcgtcacgctctcc
tgtgctctgcggacgttgacaccttctttgcgccgtcatcatgtggtgctgtgtgtgaat
cctgacggctgccagttggggttacgggccaatgctaatggtgtggatttaaacagaaac
tttccggcggcgaactggaaggaaggtgaaaccgtttatcgctggaacagcgccgctgaa
gaacgcgatgtcgtattactgacaggtgacaaacctggctccgaacctgaaacccaggcg
ctgtgccagcttatacaccgcattcaacctgcctgggtggtctcattccacgatccactg
gcctgtattgaagatcccagacacagcgaattaggcgaatggctggctcaggcgtttgaa
ttgcctctggtaaccagcgtcggttatgaaacgcctggctctttcggcagttggtgtgca
gatctgaacttgcattgcatcaccgcagagtttccgcccatctcctccgacgaagccagc
gaaaaatatctctttgcgatggcaaacttgctgcgctggcatcctaaagatgcaattcgc
ccgtcgtga
              
                            

Download fasta file
RegulonDB