RegulonDB RegulonDB 10.8: Gene Sequence
pgrR gene sequence


Size: 900        A: 231  T: 250  G: 224  C: 195

Fasta

 

>pgrR E. coli K12. Version NC_000913.3 GI:556503834
atgaagcgtgaagaaatcgctgatctgatggcgtttgtcgtcgttgcagaggagcgtagc
ttcactcgtgcagcagcccgcctgagcatggcgcagtcagctttaagccagatagtgcgt
cgtatagaagaacgattgggattgcggcttctgacgcgaaccacgcgcagcgttgttcca
actgaagcgggcgagcatcttttgtctgttcttggccctatgttgcatgacatagattca
gccatggcatccctgagcgatctgcagaaccgcccatccgggacaatacgtattactact
gtagaacatgcagcaaaaacgatattgttaccagcaatgcgcacattcctgaaatcgcat
cctgaaattgatattcagctcaccattgattatggtttgaccgatgtcgtttctgaacgt
tttgatgcaggcgtccgtctgggtggggagatggataaagatatgatcgccattcgaatc
gggccagatataccaatggctattgttggctcaccggattatttttctcgccgaagtgtt
ccaacgtcagtgtcacaattaatagatcatcaggcaattaatttgtatcttcccacatcg
ggtacagcaaatcgctggagattaatacgcggtggacgtgaagttcgtgttcgcatggaa
ggtcagcttttactgaatacgatagacctgatcattgatgctgcaattgatgggcatgga
ttggcgtatctaccttatgatcaggttgagcgggctattaaagaaaaaaaactgatacgt
gttttggataaattcacaccagatttacccggttatcacctgtactatccacaccgtcga
catgctggctcggcattctcattatttatagataggctgaagtataaaggtgctgtttag
              
                            

Download fasta file
RegulonDB