RegulonDB RegulonDB 10.9: Gene Sequence
ynaJ gene sequence


Size: 258        A: 57  T: 84  G: 71  C: 46

Fasta

 

>ynaJ E. coli K12. Version NC_000913.3 GI:556503834
atgattatggcgaaactgaagtcagcgaaagggaagaaatttctctttggtttgttggcg
gttttcattattgcggcgtcggttgtgactcgcgcgaccatcggcggcgttatagaacag
tacaatattccgctgtctgagtggacgacatcaatgtatgtgattcagtcatcgatgatt
tttgtttatagcctggtctttactgtgttgctggcaatcccgttgggaatttatttcctt
ggcggcgaagagcagtaa
              
                            

Download fasta file
RegulonDB