RegulonDB RegulonDB 10.8: Gene Sequence
ydaG gene sequence


Size: 135        A: 36  T: 35  G: 38  C: 26

Fasta

 

>ydaG E. coli K12. Version NC_000913.3 GI:556503834
atggtgcattacgaagtagttcagtatttgatggattgttgcggtatcacttacaaccag
gctgtgcaggctttacgcagcaacgactgggatctctggcaggcagaagtcgctatacgt
agcaacaagatgtga
              
                            

Download fasta file
RegulonDB