RegulonDB RegulonDB 10.9: Gene Sequence
paaZ gene sequence


Size: 2046        A: 461  T: 476  G: 607  C: 502

Fasta

 

>paaZ E. coli K12. Version NC_000913.3 GI:556503834
atgcagcagttagccagtttcttatccggtacctggcagtctggccggggccgtagccgt
ttgattcaccacgctattagcggcgaggcgttatgggaagtgaccagtgaaggtcttgat
atggcggctgcccgccagtttgccattgaaaaaggtgcccccgcccttcgcgctatgacc
tttatcgaacgtgcggcgatgcttaaagcggtcgctaaacatctgctgagtgaaaaagag
cgtttctatgctctttctgcgcaaacaggcgcaacgcgggcagacagttgggttgatatt
gaaggtggcattgggacgttatttacttacgccagcctcggtagccgggagctgcctgac
gatacgctgtggccggaagatgaattgatccccttatcgaaagaaggtggatttgccgcg
cgccatttactgacctcaaagtcaggcgtggcagtgcatattaacgcctttaacttcccc
tgctggggaatgctggaaaagctggcaccaacgtggctgggcggaatgccagccatcatc
aaaccagctaccgcgacggcccaactgactcaggcgatggtgaaatcaattgtcgatagt
ggtcttgttcccgaaggcgcaattagtctgatctgcggtagtgctggcgacttgttggat
catctggacagccaggatgtggtgactttcacggggtcagcggcgaccggacagatgctg
cgagttcagccaaatatcgtcgccaaatctatccccttcactatggaagctgattccctg
aactgctgcgtactgggcgaagatgtcaccccggatcaaccggagtttgcgctgtttatt
cgtgaagttgtgcgtgagatgaccacaaaagccgggcaaaaatgtacggcaatccggcgg
attattgtgccgcaggcattggttaatgctgtcagtgatgctctggttgcgcgattacag
aaagtcgtggtcggtgatcctgctcaggaaggcgtgaaaatgggcgcactggtaaatgct
gagcagcgtgccgatgtgcaggaaaaagtgaacatattgctggctgcaggatgcgagatt
cgcctcggtggtcaggcggatttatctgctgcgggtgccttcttcccgccaaccttattg
tactgtccgcagccggatgaaacaccggcggtacatgcaacagaagcctttggccctgtc
gcaacgctgatgccagcacaaaaccagcgacatgctctgcaactggcttgtgcaggcggc
ggtagccttgcgggaacgctggtgacggctgatccgcaaattgcgcgtcagtttattgcc
gacgcggcacgtacgcatgggcgaattcagatcctcaatgaagagtcggcaaaagaatcc
accgggcatggctccccactgccacaactggtacatggtgggcctggtcgcgcaggaggc
ggtgaagaattaggcggtttacgagcggtgaaacattacatgcagcgaaccgctgttcag
ggtagtccgacgatgcttgccgctatcagtaaacagtgggtgcgcggtgcgaaagtcgaa
gaagatcgtattcatccgttccgcaaatattttgaggagctacaaccaggcgacagcctg
ttgactccccgccgcacaatgacagaggccgatattgttaactttgcttgcctcagcggc
gatcatttctatgcacatatggataagattgctgctgccgaatctattttcggtgagcgg
gtggtgcatgggtattttgtgctttctgcggctgcgggtctgtttgtcgatgccggtgtc
ggtccggtcattgctaactacgggctggaaagcttgcgttttatcgaacccgtaaagcca
ggcgataccatccaggtgcgtctcacctgtaagcgcaagacgctgaaaaaacagcgtagc
gcagaagaaaaaccaacaggtgtggtggaatgggctgtagaggtattcaatcagcatcaa
accccggtggcgctgtattcaattctgacgctggtggccaggcagcacggtgattttgtc
gattaa
              
                            

Download fasta file
RegulonDB