RegulonDB RegulonDB 10.10: Gene Sequence
paaC gene sequence


Size: 747        A: 183  T: 168  G: 208  C: 188

Fasta

 

>paaC E. coli K12. Version NC_000913.3 GI:556503834
atgaatcagttaacggcttacaccttgcgcctgggcgataactgcctggtgctctcccag
cggttgggtgaatggtgcggtcacgcaccggaactggaaatcgatctcgcactggcaaac
attggcctcgatttattaggtcaggcacgcaacttcttatcgtatgccgctgaattagcg
ggagaaggcgatgaagataccctggccttcacccgagacgagcgccagttcagcaactta
ttgttggttgaacaaccaaacggcaattttgccgacaccattgcacgccagtatttcatc
gatgcatggcatgtggcgctctttacccgtctgatggaaagccgtgatccgcaactggcg
gcgatttctgccaaagcaattaaagaagcgcgctatcacctgcgttttagtcgtggctgg
ctggagcgactgggcaatggtactgacgtatcagggcaaaagatgcagcaggccatcaac
aagttgtggcgttttaccgccgaactgttcgatgccgacgagattgatattgcactgagt
gaagagggtattgcggttgatccacgcactttacgcgcagcgtgggaagccgaagttttt
gccgggatcaacgaagccacattgaacgtaccgcaagagcaggcgtatcgcactggcggt
aaaaaaggactgcataccgaacaccttggacccatgctggcagaaatgcagtatctccag
cgtgtcttgcccggtcagcaatggtaa
              
                            

Download fasta file
RegulonDB