RegulonDB RegulonDB 10.10: Gene Sequence
paaX gene sequence


Size: 951        A: 211  T: 261  G: 263  C: 216

Fasta

 

>paaX E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaacttgatacttttatccaacatgctgtaaacgctgttccggtcagtggcaca
tctttgatctcctctctgtatggtgattcgctttcccatcgtggtggtgaaatctggttg
ggtagtctggctgctttgctggaagggctgggatttggtgagcgtttcgtgcgcaccgct
ttgtttcgtcttaataaagaaggctggctggatgtttcccgcatcgggcgacgcagtttc
tatagcctcagtgataaaggcttgcgcctgacgcgacgggcagaaagtaaaatttatcgc
gcagagcaacctgcatgggatggtaaatggctcctgttgctctcggaaggtttagataaa
tcaacgctggctgatgtcaaaaagcagttgatctggcaaggttttggcgcactggcaccc
agcctgatggcatcgccgtcgcaaaaactggccgatgtacagacacttttgcatgaagcg
ggtgtggcggataacgtgatttgttttgaagcgcaaataccactggcgctttctcgcgca
gcactgcgtgccagagtagaagagtgctggcatttaactgaacaaaatgccatgtacgaa
acctttattcagtcattccgcccgctggtgccgcttttaaaagaggcggcagacgagtta
accccggagcgggcatttcatattcagcttttactgatccatttttatcgccgtgtcgtc
cttaaagacccattgttgccggaggagttgcttccggcacactgggcagggcatacggcg
cgtcagctgtgtatcaacatttatcagcgcgtagcgcctgctgctttagcgttcgttagt
gaaaaaggtgaaacctcggtcggtgaactgcctgcgccgggaagcctgtattttcaacgt
tttggcggcttgaatattgaacaggaggcgttatgccaatttatcagatag
              
                            

Download fasta file
RegulonDB