RegulonDB RegulonDB 10.9: Gene Sequence
ynbA gene sequence


Size: 606        A: 125  T: 199  G: 144  C: 138

Fasta

 

>ynbA E. coli K12. Version NC_000913.3 GI:556503834
atgacgctctaccagataaaaccgctctttcagtcgctgttaaggccgacgatgttttgg
ctttataagcaccacgttacagcgaatcacatcactcttgctgcactggcgctttctctt
cttaccggattgctgttgatgttggcggcacaacccatcctctttttgctattgcccatc
gtgctttttatccgtatggcgctcaatgcgctggatggcatgttggcgcgtgagtgcaac
cagcaaacacgtctgggggcgattttgaatgagactggcgatgttatttccgatattgcg
ctctatttaccatttttatttttaccggaaagtaacgcatcactcgtgatactcatgtta
ttttgcaccatattgaccgagttttgcggtttactcgcgcagacgattaacggtgttcgc
agttatgccggtccatttggcaaaagcgatcgcgcgttaatatttggtctgtggggtctg
gccgttgccatttatccacagtggatgcagtggaataatcttttatggagcattgcttca
attctgcttctctggactgcgattaatcgttgtcggagtgtgcttcttatgagcgctgaa
atataa
              
                            

Download fasta file
RegulonDB