RegulonDB RegulonDB 10.9: Gene Sequence
ynbB gene sequence


Size: 897        A: 203  T: 303  G: 221  C: 170

Fasta

 

>ynbB E. coli K12. Version NC_000913.3 GI:556503834
atgctggaaaaatctctggcaacacttttcgcgttgttaattttagcaacgctgataaac
cgttttctgctatggcggttaccggagagaaaagggggtgaggttacattacgtattcgt
acctggtggggcatcgtcatttgtttttcaatggtgatttcaggtccacgctggatgacg
ttgacgttttttgcgctgataagttttctggcattgaaagaatattgtacgcttatatct
gtacattttccgcgttggttatattggggtattcctcttaactatttgcttatcggtttt
aattgctttgagctgtttctgttatttatacctttggctgggtttctgatattagccacc
gggcaagttttagtgggtgacccctctggttttctgcataccgtgagcgccattttttgg
ggctggataatgaccgttttcgccttgagtcatgccgcctggttattaatgttgccaacc
acaaatatccagggcggggcgttactggtgttatttcttttggcattaaccgagtcaaac
gatattgcacagtatttatggggaaaatcctgcggcagaagaaaagtggtccctaaagtc
agcccgggaaaaacattggaaggtctgatgggcggcgtcatcaccatcatgattgcgtca
ctgattatcggaccgttactgacaccgctaaatacattacaggcattattagcgggtttg
ttaattggtattagtggtttttgcggcgatgtcgtgatgtcagccatcaaacgagatatt
ggtgttaaagatagcggaaaactattgccaggacatggcggactccttgacaggattgac
tcattaattttcaccgctccggtatttttttattttatacgctactgctgttactga
              
                            

Download fasta file
RegulonDB