RegulonDB RegulonDB 11.1: Gene Sequence
yncJ gene sequence


Size: 231        A: 61  T: 57  G: 72  C: 41

Fasta

 

>yncJ E. coli K12. Version NC_000913.3 GI:556503834
atgtttacgaaggcgttatcggttgtcttattaacgtgtgctctgttttcaggacaactc
atggcagggcacaaaggacatgaatttgtgtgggtaaagaatgtggatcatcagctgcgt
catgaagcggacagcgatgaattgcgtgctgtggcggaagagtcggcggaaggtttgcgc
gagcatttttactggcaaaaatcgcgcaaaccagaagcgggacaacgttga
              
                            

Download fasta file
RegulonDB