RegulonDB RegulonDB 10.8: Gene Sequence
hicB gene sequence


Size: 417        A: 109  T: 118  G: 95  C: 95

Fasta

 

>hicB E. coli K12. Version NC_000913.3 GI:556503834
atgcgttatcccgtcactcttacacccgcgccggaaggcggttatatggtttcttttgtg
gatatccctgaagcgttgacccagggcgaaactgtcgctgaagcgatggaagcggcaaaa
gatgctttactgaccgcatttgatttttattttgaagataacgagcttatccctttacct
tcgccattaaatagtcacgatcactttattgaagtacctttgagcgtcgcctctaaggta
ttgctgttaaatgcttttttacagtcagaaatcactcagcaagagttagccaggcgaatt
ggcaaacctaaacaggagattactcgcctatttaacttgcatcatgcgacaaaaatcgac
gccgtccagctcgcggcaaaggcgcttggcaaagagttatcgctggtgatggtttaa
              
                            

Download fasta file
RegulonDB