RegulonDB RegulonDB 10.8: Gene Sequence
yddM gene sequence


Size: 285        A: 80  T: 59  G: 78  C: 68

Fasta

 

>yddM E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatggccaatcatccccgcccgggggacattattcaggaatcactggacgaactt
aatgtcagcctgcgcgagtttgccagagcaatggaaattgctccctcaacggcaagccga
ttgctgacaggaaaagcagctttgacgccagaaatggcgattaaactttccgtggtgatc
ggcagttcgccgcaaatgtggctgaatctgcaaaacgcctggagtctggcagaggcagaa
aaaacagtggatgtgtcgcgattacgccgtctggttacgcaataa
              
                            

Download fasta file
RegulonDB