RegulonDB RegulonDB 10.8: Gene Sequence
adhP gene sequence


Size: 1011        A: 244  T: 237  G: 301  C: 229

Fasta

 

>adhP E. coli K12. Version NC_000913.3 GI:556503834
atgaaggctgcagttgttacgaaggatcatcatgttgacgttacgtataaaacactgcgc
tcactgaaacatggcgaagccctgctgaaaatggagtgttgtggtgtatgtcataccgat
cttcatgttaagaatggcgattttggtgacaaaaccggcgtaattctgggccatgaaggc
atcggtgtggtggcagaagtgggtccaggtgtcacctcattaaaaccaggcgatcgtgcc
agcgtggcgtggttctacgaaggatgcggtcattgcgaatactgtaacagtggtaacgaa
acgctctgccgttcagttaaaaatgccggatacagcgttgatggcgggatggcggaagag
tgcatcgtggtcgccgattacgcggtaaaagtgccagatggtctggactcggcggcggcc
agcagcattacctgtgcgggagtcaccacctacaaagccgttaagctgtcaaaaattcgt
ccagggcagtggattgctatctacggtcttggcggtctgggtaacctcgccctgcaatac
gcgaagaatgtctttaacgccaaagtgatcgccattgatgtcaatgatgagcagttaaaa
ctggcaaccgaaatgggcgcagatttagcgattaactcacacaccgaagacgccgccaaa
attgtgcaggagaaaactggtggcgctcacgctgcggtggtaacagcggtagctaaagct
gcgtttaactcggcagttgatgctgtccgtgcaggcggtcgtgttgtggctgtcggtcta
ccgccggagtctatgagcctggatatcccacgtcttgtgctggatggtattgaagtggtc
ggttcgctggtcggcacgcgccaggatttaactgaagccttccagtttgccgccgaaggt
aaagtggtgccgaaagtcgccctgcgtccgttagcggacatcaacaccatctttactgag
atggaagaaggcaaaatccgtggccgcatggtgattgatttccgtcactaa
              
                            

Download fasta file
RegulonDB